September 23, 2021

Expertise From Incorporating a Related Genetic Illness All through a Course

In Vitro Assays to Examine PD-1 Biology in Human T Cells

Our understanding of programmed cell demise 1 (PD-1) biology is proscribed as a result of technical difficulties in establishing reproducible, but easy, in vitro assays to check PD-1 signaling in main human T cells. The protocols on this article had been refined to check the implications of PD-1 ligation on short-term T cell signaling, long-term T cell perform, and the structural penalties of PD-1 ligation with PD-1 ligands. 

  • Fundamental Protocol 1 addresses the necessity for a sturdy and reproducible short-term assay to look at the signaling cascade triggered by PD-1. We describe a phospho stream cytometry technique to find out how PD-1 ligation alters the extent of CD3ζ phosphorylation on Tyr142 , which might be simply utilized to different proximal signaling proteins.

  • Fundamental Protocol 2 describes a plate-bound assay that’s helpful to look at the long-term penalties of PD-1 ligation comparable to cytokine manufacturing and T cell proliferation.
  • Complementary to that, Fundamental Protocol Three describes an in vitro superantigen-based assay to judge T cell responses to therapeutic brokers focusing on the PD-1/PD-L axis, in addition to immune synapse formation within the presence of PD-1 engagement. Lastly, in Fundamental Protocol Four we define a tetramer-based technique helpful to interrogate the standard of PD-1/PD-L interactions.
  • These protocols might be simply tailored for mouse research and different inhibitory receptors. They supply a beneficial useful resource to analyze PD-1 signaling in T cells and the purposeful penalties of varied PD-1-based therapeutics on T cell responses.
  • © 2020 Wiley Periodicals LLC. Fundamental Protocol 1: PD-1 crosslinking assay to find out CD3ζ phosphorylation in main human T cells Fundamental Protocol 2: Plate-based ligand binding assay to check PD-1 perform in human T cells Help Protocol 1: T cell proliferation assay within the presence of PD-1 ligation Fundamental Protocol 3: In vitro APC/T cell co-culture system to judge therapeutic interventions focusing on the PD-1/PD-L1 axis Help Protocol 2: Microscopy-based strategy to judge the implications of PD-1 ligation on immune synapse formation Fundamental Protocol 4: Tetramer-based strategy to check PD-1/PD-L1 interactions.

Tailor-made Educating for Specialised (Para-)medical College students – Expertise From Incorporating a Related Genetic Illness All through a Course of Molecular Cell Biology

Worldwide, a compulsory course in Molecular Cell Biology is commonly a part of the (para-) medical curricula. Pupil audiences are commonly not receptive to such comparatively theoretical programs and academics typically battle to convey the mandatory data.

Right here, constructive expertise is shared on rigorously embedding a genetic illness that severely impacts the motion equipment, fibrodysplasia ossificans progressiva (FOP), in all points of a course for a global group of Analysis Grasp Human Motion Sciences college students. 

Varied molecular cell organic points of FOP had been systematically carried out within the course, protecting genetics, the biochemical penalties of the mutation, signaling pathways that have an effect on bone formation and lectures on methods to clone the mutation or treatment the mutation. College students had been invited to critically take into consideration methods to use the theories discovered within the course to investigate a analysis paper.

Through the sensible a part of the course, college students assisted in novel, innovative analysis on FOP affected person derived or management cells. Analysis findings had been reported in a analysis paper format. By constructing a Molecular Cell Biology course round an interesting illness, we managed to extend the overall motivation of the scholars for the course as mirrored in two particular questions of the course evaluations (p < 0.05).

It convincingly taught the relevance of a course of Molecular Cell Biology to college students with a main background in biomechanics and physiotherapy for his or her paramedical skilled life. This strategy of embedding an audience-tailored human illness with a recognized genetic trigger right into a course might be carried out to many medical curriculum associated programs and can improve college students’ notion of the relevance of a course. 

Human Hexokinase 1 (HK1) ELISA Kit

RD-HK1-Hu-96Tests 96 Tests
EUR 662

HK1 Rabbit pAb

A1054-100ul 100 ul
EUR 308

HK1 Rabbit pAb

A1054-200ul 200 ul
EUR 459

HK1 Rabbit pAb

A1054-20ul 20 ul
EUR 183

HK1 Rabbit pAb

A1054-50ul 50 ul
EUR 223

HK1 Rabbit pAb

A0546-100ul 100 ul
EUR 308

HK1 Rabbit pAb

A0546-200ul 200 ul
EUR 459

HK1 Rabbit pAb

A0546-20ul 20 ul Ask for price

HK1 Rabbit pAb

A0546-50ul 50 ul Ask for price

Rabbit HK1 ELISA Kit

ERTH0075 96Tests
EUR 521

HK1 antibody

70R-17747 50 ul
EUR 435
Description: Rabbit polyclonal HK1 antibody

HK1 antibody

70R-10229 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal HK1 antibody

HK1 antibody

70R-10230 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal HK1 antibody

HK1 Antibody

32133-100ul 100ul
EUR 252

HK1 antibody

10R-2226 100 ul
EUR 403
Description: Mouse monoclonal HK1 antibody

HK1 antibody

10R-2231 100 ul
EUR 403
Description: Mouse monoclonal HK1 antibody

HK1 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against HK1. Recognizes HK1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000

HK1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against HK1. Recognizes HK1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

HK1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against HK1. Recognizes HK1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

HK1 Antibody

DF6199 200ul
EUR 304
Description: HK1 Antibody detects endogenous levels of total HK1.

HK1 Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against HK1. Recognizes HK1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

HK1 Antibody

CSB-PA230660-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against HK1. Recognizes HK1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

HK1 antibody

70R-35878 100 ug
EUR 349
Description: Rabbit polyclonal HK1 antibody

HK1 Antibody

BF0126 200ul
EUR 376
Description: HK1 antibody detects endogenous levels of total HK1.

HK1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against HK1. Recognizes HK1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

HK1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HK1. Recognizes HK1 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

HK1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HK1. Recognizes HK1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

HK1 Antibody

ABD6199 100 ug
EUR 438

[KO Validated] HK1 Rabbit mAb

A0533-100ul 100 ul
EUR 459

[KO Validated] HK1 Rabbit mAb

A0533-200ul 200 ul
EUR 686

[KO Validated] HK1 Rabbit mAb

A0533-20ul 20 ul
EUR 221

[KO Validated] HK1 Rabbit mAb

A0533-50ul 50 ul
EUR 308

HK1 Monoclonal Antibody

27098-100ul 100ul
EUR 252

HK1 Monoclonal Antibody

27098-50ul 50ul
EUR 187

HK1/HK2 antibody

31975-100ul 100ul
EUR 252

HK1/HK2 antibody

31975-50ul 50ul
EUR 187

HK1 Conjugated Antibody

C32133 100ul
EUR 397

HK1 Polyclonal Antibody

A54337 100 µg
EUR 570.55
Description: Ask the seller for details

HK1 Polyclonal Antibody

A54597 100 µg
EUR 570.55
Description: Ask the seller for details

anti- HK1 antibody

FNab03893 100µg
EUR 505.25
  • Immunogen: hexokinase 1
  • Uniprot ID: P19367
  • Gene ID: 3098
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against HK1

Anti-HK1 antibody

PAab03893 100 ug
EUR 355

Anti-HK1 antibody

STJ110988 100 µl
EUR 277
Description: Hexokinases phosphorylate glucose to produce glucose-6-phosphate, the first step in most glucose metabolism pathways. This gene encodes a ubiquitous form of hexokinase which localizes to the outer membrane of mitochondria. Mutations in this gene have been associated with hemolytic anemia due to hexokinase deficiency. Alternative splicing of this gene results in several transcript variants which encode different isoforms, some of which are tissue-specific.

Anti-HK1 antibody

STJ24019 100 µl
EUR 277
Description: Hexokinases phosphorylate glucose to produce glucose-6-phosphate, the first step in most glucose metabolism pathways. This gene encodes a ubiquitous form of hexokinase which localizes to the outer membrane of mitochondria. Mutations in this gene have been associated with hemolytic anemia due to hexokinase deficiency. Alternative splicing of this gene results in several transcript variants which encode different isoforms, some of which are tissue-specific.

Rabbit Anti-HK1 monoclonal antibody, clone TU58-16

DCABH-4091 100 ul
EUR 777


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Hexokinase 1 (HK1) Antibody

abx015885-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

Hexokinase 1 (HK1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Hexokinase 1 (HK1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Hexokinase 1 (HK1) Antibody

  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Hexokinase 1 (HK1) Antibody

  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Hexokinase 1 (HK1) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Hexokinase 1 (HK1) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Hexokinase 1 (HK1) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Hexokinase 1 (HK1) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Hexokinase 1 (HK1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Hexokinase 1 (HK1) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Hexokinase 1 (HK1) Antibody

  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Hexokinase 1 (HK1) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Hexokinase 1 (HK1) Antibody

abx036294-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Hexokinase 1 (HK1) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Hexokinase-1 (HK1) Antibody

  • EUR 704.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Hexokinase 1 (HK1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Hexokinase 1 (HK1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Hexokinase 1 (HK1) Antibody

abx159534-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

Hexokinase 1 (HK1) Antibody

  • EUR 787.00
  • EUR 411.00
  • 1 mg
  • 200 ug
  • Please enquire.

Hexokinase 1 (HK1) Antibody

abx010915-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

Hexokinase 1 (HK1) Antibody

abx033903-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Hexokinase 1 (HK1) Antibody

abx033903-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Hexokinase 1 (HK1) Antibody

abx033904-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Hexokinase 1 (HK1) Antibody

abx033904-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

HK1 Conjugated Monoclonal Antibody

C27098 100ul
EUR 397

HK1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HK1. Recognizes HK1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

HK1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HK1. Recognizes HK1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

HK1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HK1. Recognizes HK1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

HK1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HK1. Recognizes HK1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

HK1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HK1. Recognizes HK1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

HK1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HK1. Recognizes HK1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Hexokinase 1 (HK1) Antibody

abx233847-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Hexokinase 1 (HK1) Antibody

abx233893-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Hexokinase 1 (HK1) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Hexokinase 1 (HK1) Antibody

abx332645-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Hexokinase 1 (HK1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Anti-Hexokinase 1/HK1 Antibody

A01504-1 100ug/vial
EUR 334

Hexokinase 1 (HK1) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Hexokinase 1 (HK1) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Hexokinase 1 (HK1) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Hexokinase 1 (HK1) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Hexokinase 1 (HK1) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Hexokinase 1 (HK1) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

HK1/HK2 Polyclonal Conjugated Antibody

C31975 100ul
EUR 397

Monoclonal HK1 Antibody, Clone: 3A10

APR07757G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human HK1. The antibodies are raised in Mouse and are from clone 3A10. This antibody is applicable in WB and IHC, FC, ICC, E

Polyclonal HK1 Antibody (C-term)

APR07758G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HK1 (C-term). This antibody is tested and proven to work in the following applications:

Hexokinase 1 (HK1) Antibody (Biotin)

  • EUR 425.00
  • EUR 230.00
  • EUR 1191.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Hexokinase 1 (HK1) Antibody (Biotin)

  • EUR 425.00
  • EUR 230.00
  • EUR 1219.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Hexokinase 1 (HK1) Antibody (Biotin)

  • EUR 481.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Monoclonal HK1 Antibody, Clone: 7A7

AMM02783G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human HK1. The antibodies are raised in Mouse and are from clone 7A7. This antibody is applicable in WB and IHC, ICC, E

HK1 Polyclonal Antibody, Biotin Conjugated

A54338 100 µg
EUR 570.55
Description: The best epigenetics products

HK1 Polyclonal Antibody, FITC Conjugated

A54339 100 µg
EUR 570.55
Description: kits suitable for this type of research

HK1 Polyclonal Antibody, HRP Conjugated

A54340 100 µg
EUR 570.55
Description: fast delivery possible

HK1 Polyclonal Antibody, HRP Conjugated

A54598 100 µg
EUR 570.55
Description: The best epigenetics products

HK1 Polyclonal Antibody, FITC Conjugated

A54599 100 µg
EUR 570.55
Description: kits suitable for this type of research

HK1 Polyclonal Antibody, Biotin Conjugated

A54600 100 µg
EUR 570.55
Description: fast delivery possible

[One Step] HK1 Antibody Kit

RK05655 50 ul
EUR 240

Anti-HK1 (KO Validated) Antibody

A2125-100 100 µl
EUR 465

HK1 Blocking Peptide

33R-4063 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HK1 antibody, catalog no. 70R-10229

HK1 Blocking Peptide

33R-1787 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HK1 antibody, catalog no. 70R-10230

HK1 Blocking Peptide

DF6199-BP 1mg
EUR 195

HK1 Blocking Peptide

BF0126-BP 1mg
EUR 195

HK1 cloning plasmid

CSB-CL010468HU-10ug 10ug
EUR 558
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2754
  • Sequence: atgatcgccgcgcagctcctggcctattacttcacggagctgaaggatgaccaggtcaaaaagattgacaagtatctgtatgccatgcggctctccgatgaaactctcatagatatcatgactcgcttcaggaaggagatgaagaatggcctctcccgggattttaatccaacag
  • Show more
Description: A cloning plasmid for the HK1 gene.

anti-HK1 (7A7)

LF-MA30442 100 ul
EUR 486
Description: Mouse Monoclonal to HK1

anti-HK1 (3A10)

LF-MA30447 100 ul
EUR 486
Description: Mouse Monoclonal to HK1

pENTR223-HK1 vector

PVT11902 2 ug
EUR 308

Polyclonal HK1 antibody - N-terminal region

APR07759G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HK1 - N-terminal region. This antibody is tested and proven to work in the following applications:

Hexokinase 1 (HK1) Polyclonal Antibody (Human)

  • EUR 232.00
  • EUR 2285.00
  • EUR 574.00
  • EUR 289.00
  • EUR 208.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HK1 (Phe80~Met215)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hexokinase 1 (HK1)

Hexokinase 1 (HK1) Polyclonal Antibody (Human)

  • EUR 232.00
  • EUR 2285.00
  • EUR 574.00
  • EUR 289.00
  • EUR 208.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HK1 (Asp413~Val540)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hexokinase 1 (HK1)

Hexokinase 1 (HK1) Polyclonal Antibody (Mouse)

  • EUR 236.00
  • EUR 2338.00
  • EUR 586.00
  • EUR 294.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HK1 (Ala530~Gly675)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Hexokinase 1 (HK1)

Hexokinase 1 (HK1) Polyclonal Antibody (Mouse)

  • EUR 236.00
  • EUR 2338.00
  • EUR 586.00
  • EUR 294.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HK1 (Leu676~Val800)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Hexokinase 1 (HK1)

Hexokinase 1 (HK1) Polyclonal Antibody (Rat)

  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HK1 (Phe80~Met215)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Hexokinase 1 (HK1)

Hexokinase 1 (HK1) Polyclonal Antibody (Rat)

  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HK1 (Asp413~Val540)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Hexokinase 1 (HK1)

Human Hexokinase-1 (HK1)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 55.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Hexokinase-1(HK1),partial expressed in E.coli

Human Hexokinase-1 (HK1)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 65.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Hexokinase-1(HK1),partial expressed in E.coli

Human Hexokinase-1 (HK1)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 106.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Hexokinase-1(HK1) expressed in E.coli

Human Hexokinase-1 (HK1)

  • EUR 430.00
  • EUR 234.00
  • EUR 1508.00
  • EUR 642.00
  • EUR 1009.00
  • EUR 291.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 53.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Hexokinase-1(HK1) ,partial expressed in Yeast

Human HK1 ELISA Kit

EHH0075 96Tests
EUR 521

Human HK1 ELISA Kit

ELA-E0775h 96 Tests
EUR 824

Goat HK1 ELISA Kit

EGTH0075 96Tests
EUR 521

Bovine HK1 ELISA Kit

EBH0075 96Tests
EUR 521

Canine HK1 ELISA Kit

ECH0075 96Tests
EUR 521

Chicken HK1 ELISA Kit

ECKH0075 96Tests
EUR 521

Anserini HK1 ELISA Kit

EAH0075 96Tests
EUR 521


EF005611 96 Tests
EUR 689

Rat HK1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human HK1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse HK1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ERH0075 96Tests
EUR 521

Mouse HK1 ELISA Kit

EMH0075 96Tests
EUR 521

Monkey HK1 ELISA Kit

EMKH0075 96Tests
EUR 521

Porcine HK1 ELISA Kit

EPH0075 96Tests
EUR 521

Recombinant Hexokinase 1 (HK1)

  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P19367
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 16.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Hexokinase 1 expressed in: E.coli

Recombinant Hexokinase 1 (HK1)

  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P19367
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 41.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Hexokinase 1 expressed in: E.coli

Recombinant Hexokinase 1 (HK1)

  • EUR 481.70
  • EUR 232.00
  • EUR 1531.36
  • EUR 577.12
  • EUR 1054.24
  • EUR 385.00
  • EUR 3678.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P17710
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 16.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Hexokinase 1 expressed in: E.coli

Recombinant Hexokinase 1 (HK1)

  • EUR 481.70
  • EUR 232.00
  • EUR 1531.36
  • EUR 577.12
  • EUR 1054.24
  • EUR 385.00
  • EUR 3678.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P17710
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 17.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Hexokinase 1 expressed in: E.coli

Recombinant Hexokinase 1 (HK1)

  • EUR 481.70
  • EUR 232.00
  • EUR 1531.36
  • EUR 577.12
  • EUR 1054.24
  • EUR 385.00
  • EUR 3678.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P17710
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 15.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Hexokinase 1 expressed in: E.coli

Recombinant Hexokinase 1 (HK1)

  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P05708
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 16.7kDa
  • Isoelectric Point: 7.1
Description: Recombinant Rat Hexokinase 1 expressed in: E.coli

Recombinant Hexokinase 1 (HK1)

  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P05708
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 46.6kDa
  • Isoelectric Point: 7.7
Description: Recombinant Rat Hexokinase 1 expressed in: E.coli

Hexokinase 1 (HK1) Polyclonal Antibody (Human), APC

  • EUR 323.00
  • EUR 2969.00
  • EUR 836.00
  • EUR 409.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HK1 (Phe80~Met215)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hexokinase 1 (HK1). This antibody is labeled with APC.

Hexokinase 1 (HK1) Polyclonal Antibody (Human), Biotinylated

  • EUR 295.00
  • EUR 2235.00
  • EUR 671.00
  • EUR 358.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HK1 (Phe80~Met215)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hexokinase 1 (HK1). This antibody is labeled with Biotin.

Hexokinase 1 (HK1) Polyclonal Antibody (Human), Cy3

  • EUR 390.00
  • EUR 3917.00
  • EUR 1073.00
  • EUR 504.00
  • EUR 239.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HK1 (Phe80~Met215)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hexokinase 1 (HK1). This antibody is labeled with Cy3.

Hexokinase 1 (HK1) Polyclonal Antibody (Human), FITC

  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HK1 (Phe80~Met215)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hexokinase 1 (HK1). This antibody is labeled with FITC.

Hexokinase 1 (HK1) Polyclonal Antibody (Human), HRP

  • EUR 297.00
  • EUR 2589.00
  • EUR 741.00
  • EUR 371.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HK1 (Phe80~Met215)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hexokinase 1 (HK1). This antibody is labeled with HRP.

Hexokinase 1 (HK1) Polyclonal Antibody (Human), PE

  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HK1 (Phe80~Met215)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hexokinase 1 (HK1). This antibody is labeled with PE.

Hexokinase 1 (HK1) Polyclonal Antibody (Human), APC

  • EUR 323.00
  • EUR 2969.00
  • EUR 836.00
  • EUR 409.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HK1 (Asp413~Val540)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hexokinase 1 (HK1). This antibody is labeled with APC.

Hexokinase 1 (HK1) Polyclonal Antibody (Human), Biotinylated

  • EUR 295.00
  • EUR 2235.00
  • EUR 671.00
  • EUR 358.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HK1 (Asp413~Val540)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hexokinase 1 (HK1). This antibody is labeled with Biotin.

Hexokinase 1 (HK1) Polyclonal Antibody (Human), Cy3

  • EUR 390.00
  • EUR 3917.00
  • EUR 1073.00
  • EUR 504.00
  • EUR 239.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HK1 (Asp413~Val540)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hexokinase 1 (HK1). This antibody is labeled with Cy3.

Hexokinase 1 (HK1) Polyclonal Antibody (Human), FITC

  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HK1 (Asp413~Val540)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hexokinase 1 (HK1). This antibody is labeled with FITC.

Hexokinase 1 (HK1) Polyclonal Antibody (Human), HRP

  • EUR 297.00
  • EUR 2589.00
  • EUR 741.00
  • EUR 371.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HK1 (Asp413~Val540)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hexokinase 1 (HK1). This antibody is labeled with HRP.

Hexokinase 1 (HK1) Polyclonal Antibody (Human), PE

  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HK1 (Asp413~Val540)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hexokinase 1 (HK1). This antibody is labeled with PE.

Hexokinase 1 (HK1) Polyclonal Antibody (Human, Mouse)

  • EUR 236.00
  • EUR 2338.00
  • EUR 586.00
  • EUR 294.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HK1 (Phe137~Leu270)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Hexokinase 1 (HK1)

Hexokinase 1 (HK1) Polyclonal Antibody (Mouse), APC

  • EUR 329.00
  • EUR 3041.00
  • EUR 854.00
  • EUR 416.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HK1 (Ala530~Gly675)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Hexokinase 1 (HK1). This antibody is labeled with APC.

Hexokinase 1 (HK1) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 299.00
  • EUR 2288.00
  • EUR 684.00
  • EUR 363.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HK1 (Ala530~Gly675)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Hexokinase 1 (HK1). This antibody is labeled with Biotin.

Hexokinase 1 (HK1) Polyclonal Antibody (Mouse), Cy3

  • EUR 397.00
  • EUR 4013.00
  • EUR 1097.00
  • EUR 513.00
  • EUR 241.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HK1 (Ala530~Gly675)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Hexokinase 1 (HK1). This antibody is labeled with Cy3.

Hexokinase 1 (HK1) Polyclonal Antibody (Mouse), FITC

  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HK1 (Ala530~Gly675)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Hexokinase 1 (HK1). This antibody is labeled with FITC.

Hexokinase 1 (HK1) Polyclonal Antibody (Mouse), HRP

  • EUR 302.00
  • EUR 2652.00
  • EUR 756.00
  • EUR 377.00
  • EUR 200.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HK1 (Ala530~Gly675)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Hexokinase 1 (HK1). This antibody is labeled with HRP.

Hexokinase 1 (HK1) Polyclonal Antibody (Mouse), PE

  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HK1 (Ala530~Gly675)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Hexokinase 1 (HK1). This antibody is labeled with PE.

Hexokinase 1 (HK1) Polyclonal Antibody (Mouse), APC

  • EUR 329.00
  • EUR 3041.00
  • EUR 854.00
  • EUR 416.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HK1 (Leu676~Val800)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Hexokinase 1 (HK1). This antibody is labeled with APC.

Focusing on A number of Myeloma by way of the Biology of Lengthy-Lived Plasma Cells

A number of myeloma (MM) is a hematological malignancy of terminally differentiated bone marrow (BM) resident B lymphocytes referred to as plasma cells (PC). PC that reside within the bone marrow embrace a definite inhabitants of long-lived plasma cells (LLPC) which have the capability to stay for very lengthy intervals of time (a long time within the human inhabitants).

LLPC biology is essential for understanding MM illness induction and development as a result of MM shares lots of the similar extrinsic and intrinsic survival applications as LLPC. Extrinsic survival alerts required for LLPC survival embrace soluble elements and mobile companions within the bone marrow microenvironment. Intrinsic applications that improve mobile constancy are additionally required for LLPC survival together with elevated autophagy, metabolic health, the unfolded protein response (UPR), and enhanced responsiveness to endoplasmic reticulum (ER) stress.

Focusing on LLPC cell survival mechanisms have led to straightforward of care therapies for MM together with proteasome inhibition (Bortezomib), steroids (Dexamethasone), and immunomodulatory medication (Lenalidomide). MM sufferers that relapse typically accomplish that by circumventing LLPC survival pathways focused by therapy. Understanding the mechanisms by which LLPC are capable of survive can enable us perception into the therapy of MM, which permits for the enhancement of therapeutic methods in MM each at analysis and upon affected person relapse.   


GE8159-5KG 5 kg
EUR 225


TB1943 500g
EUR 67.4
  • Product category: Biochemicals/Biology Reagents/Protein Related

Ethylene glycol

  • EUR 217.00
  • EUR 509.00
  • EUR 189.00
  • EUR 370.00
  • EUR 175.00
  • 100 g
  • 1 kg
  • 25 g
  • 500 g
  • 5 g
  • Shipped within 1-2 weeks.

Ethylene glycol

GK7641-100ML 100 ml
EUR 38

Ethylene glycol

GK7641-1L 1 l
EUR 54

Ethylene glycol

GK7641-500ML 500 ml
EUR 44

Ethylene glycol

GK7641-5L 5 l
EUR 114

Ethylene glycol

ED0199 250ml
EUR 58.7
  • Product category: Biochemicals/Misc. Biochemicals

2-Methylamino Thiourea

abx187868-100g 100 g
EUR 300
  • Shipped within 1-2 weeks.

cDNA Synthesis SuperMix for qPCR

  • EUR 690.00
  • EUR 565.00
  • 100 rxns ×20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.

Trifluoroacetic acid, Ultrapure for synthesis

GK2000-100ML 100 ml
EUR 70

Trifluoroacetic acid, Ultrapure for synthesis

GK2000-1L 1 l
EUR 293

5-Bromovaleraldehyde Ethylene Acetal

  • EUR 704.00
  • EUR 272.00
  • EUR 495.00
  • 10 g
  • 1 g
  • 5 g
  • Shipped within 1-2 weeks.


  • EUR 272.00
  • EUR 1121.00
  • 25 g
  • 500 g
  • Shipped within 1-2 weeks.

mono-(BOC)-ethylene diamine

  • EUR 272.00
  • EUR 203.00
  • EUR 648.00
  • 100 g
  • 25 g
  • 500 g
  • Shipped within 1-2 weeks.


GK7697-250G 250 g
EUR 62


GK7697-25G 25 g
EUR 44


  • EUR 356.00
  • EUR 1191.00
  • EUR 565.00
  • EUR 871.00
  • 100 mg
  • 1 g
  • 250 mg
  • 500 mg
  • Shipped within 1-2 weeks.

Poly(Ethylene Glycol) (N) Monomethacrylate

  • EUR 370.00
  • EUR 217.00
  • 100 g
  • 25 g
  • Shipped within 1-2 weeks.

Poly(ethylene glycol methyl ether)

abx181345-1000g 1000 g
EUR 342
  • Shipped within 1-2 weeks.


  • EUR 244.00
  • EUR 1288.00
  • EUR 398.00
  • 1 g
  • 25 g
  • 5 g
  • Shipped within 1-2 weeks.

N-Boc-n'-methyl thiourea

  • EUR 954.00
  • EUR 481.00
  • 1 g
  • 250 mg
  • Shipped within 1-2 weeks.

First-Strand cDNA Synthesis SuperMix for PCR

abx098018-50rxns20ulSystems 50 rxns × 20 ul Systems
EUR 578
  • Shipped within 5-10 working days.

cDNA Synthesis SuperMix for qPCR (GC-rich)

abx098024-50rxns20ulSystems 50 rxns × 20 ul Systems
EUR 718
  • Shipped within 5-10 working days.

Tri(Ethylene Glycol) Di-P-Toluenesulfonate

  • EUR 286.00
  • EUR 230.00
  • 25 g
  • 5 g
  • Shipped within 1-2 weeks.

cDNA Synthesis SuperMix

  • EUR 565.00
  • EUR 481.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.

OneScriptcDNA Synthesis Kit

G233 25 x 20 ul reactions
EUR 89

OneScriptcDNA Synthesis Kit

G234 100 x 20 ul reactions
EUR 141

OneScriptcDNA Synthesis SuperMix

G451 25 x 20 ul reactions
EUR 89

OneScriptcDNA Synthesis SuperMix

G452 100 x 20 ul reactions
EUR 141

Extraction Buffer for 2D Gel with Diluent, 50ml Urea, Thiourea and CHAPS

PL039 50ml
EUR 72.62
  • Product category: Electrophoresis Related/Buffers

Tetro cDNA Synthesis Kit

BIO-65042 30 Reactions Ask for price

Tetro cDNA Synthesis Kit

BIO-65043 100 Reactions Ask for price

SensiFAST cDNA Synthesis Kit

BIO-65053 50 Reactions Ask for price

SensiFAST cDNA Synthesis Kit

BIO-65053/S Sample Ask for price

SensiFAST cDNA Synthesis Kit

BIO-65054 250 Reactions Ask for price

OneScriptPlus cDNA Synthesis Kit

G235 25 x 20 ul reactions
EUR 97

OneScriptPlus cDNA Synthesis Kit

G236 100 x 20 ul reactions
EUR 169

OneScriptPlus cDNA Synthesis SuperMix

G453 25 x 20 ul reactions
EUR 97

OneScriptPlus cDNA Synthesis SuperMix

G454 100 x 20 ul reactions
EUR 169

circRNA cDNA Synthesis Kit

G627 25 rxn (20 ul/rxn)
EUR 309

CRISPR sgRNA Synthesis Kit

EUR 403

Glutamine Synthesis stable cells

SC013 2 x 106 cell/ml x 1ml
EUR 1210
Description: Stable cell line expressing Glutamine Synthesis gene and RFP with Blasticidin resistance

All-in-One First-Strand cDNA Synthesis SuperMix for PCR

abx098023-50rxns20ulSystems 50 rxns × 20 ul Systems
EUR 732
  • Shipped within 5-10 working days.

Extraction Buffer for 2D Gel with Diluent, 50ml Urea, Thiourea, CHAPS and ASB-16

PL040 50ml
EUR 115.25
  • Product category: Electrophoresis Related/Buffers

Extraction Buffer for 2D Gel with Diluent, 50ml Urea, Thiourea, CHAPS and NDSB 201

PL042 50ml
EUR 91.76
  • Product category: Electrophoresis Related/Buffers

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Molybdenum Cofactor Synthesis 2 Protein

  • EUR 1609.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 10 ug
  • 2 µg
  • Shipped within 5-10 working days.

Total-Transcriptome cDNA Synthesis Kit

G904 25 reactions
EUR 224

Total-Transcriptome cDNA Synthesis Kit

G905 100 reactions
EUR 544

Classic CRISPR sgRNA Synthesis Kit

K1252-25 25 Reactions
EUR 439
  • Kit components:
  • 2X Classic sgRNA Synthesis SuperMix
  • Scaffold Template and Primer
  • sgRNA Control Oligo (10 ?M)
  • OneScribe Enzyme Mix
  • DNase I, RNase-Free (2 U/?l)
  • 10X DNase I Reaction Buffer
  • DistantTM PCR Mix (#M1136-200)
  • Nuclease-free H2O
Description: Classic CRISPR sgRNA Synthesis Kit

Express CRISPR sgRNA Synthesis Kit

EUR 533

Custom Peptide Synthesis order form

Pepord-1 1 Ask for price

Accuris qMax cDNA Synthesis Kit

PR2100-C-100 1 PC
EUR 337.75
  • To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

Accuris qMax cDNA Synthesis Kit

PR2100-C-25 1 PC
EUR 142.36
  • To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

Accuris qMax cDNA Synthesis Kit

PR2100-C-250 1 PC
EUR 711.77
  • To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

Accuris qMax cDNA Synthesis Kit

PR2100-C-S 1 PC
EUR 77.76
  • To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

amfiRivert cDNA Synthesis Master Mix

R5101-050 50 rxns
EUR 415

amfiRivert cDNA Synthesis Master Mix

R5101-100 2X50 rxns
EUR 847

amfiRivert cDNA Synthesis Master Mix

R5101-200 4X50 rxns
EUR 1211

amfiRivet cDNA Synthesis 2X Buffer

R5102-050 500ul
EUR 134

amfiRivet cDNA Synthesis 2X Buffer

R5102-100 2x500ul
EUR 192

Mitomycin C (DNA synthesis inhibitor)

SIH-246-10MG 10 mg
EUR 149
  • The mitomycins are a family of aziridine containing natural products. Mitomycin C is a chemotherapeutic agent because of its mechanism of potent DNA crosslinker, reductive activation followed by two N-alklyations. Both alkylations are sequence specif
  • Show more
Description: The substance Mitomycin C is a dna synthesis inhibitor. It is synthetically produced and has a purity of >99%. The pure substance is dark purple crystalline solid which is May be dissolved in DMSO (15mg/mL); or water (1mg/mL, warm).

Mitomycin C (DNA synthesis inhibitor)

SIH-246-50MG 50 mg
EUR 373
  • The mitomycins are a family of aziridine containing natural products. Mitomycin C is a chemotherapeutic agent because of its mechanism of potent DNA crosslinker, reductive activation followed by two N-alklyations. Both alkylations are sequence specif
  • Show more
Description: The substance Mitomycin C is a dna synthesis inhibitor. It is synthetically produced and has a purity of >99%. The pure substance is dark purple crystalline solid which is May be dissolved in DMSO (15mg/mL); or water (1mg/mL, warm).

Holder for Plasmid Midi, Maxi and Maxi plus, Ion Exchange column

FAPDE-holder-for-ion-exchange 1 prep
EUR 158

Poly(ethylene glycol) methyl ether (mPEG) Molecular Weight: 20000

PEG-20K 100 mg
EUR 225

Extraction Buffer for 2D Gel with Diluent, 50ml Urea, Thiourea, CHAPS and SB 3-10

PL041 50ml
EUR 91.76
  • Product category: Electrophoresis Related/Buffers

All-in-One cDNA Synthesis SuperMix

B24403 200 ractions
EUR 456
Description: All-in-One cDNA Synthesis SuperMix contains all the necessary components pre-blended in one tube for reverse transcription.

All-in-One cDNA Synthesis SuperMix

B24408 1000 ractions
EUR 1453
Description: All-in-One cDNA Synthesis SuperMix contains all the necessary components pre-blended in one tube for reverse transcription.

AzuraQuant cDNA Synthesis Kit - 25 Reactions

AZ-1995 25 Reactions
EUR 153

AzuraQuant cDNA Synthesis Kit - 100 Reactions

AZ-1996 100 Reactions
EUR 372

Molybdenum Cofactor Synthesis 1 (MOCS1) Antibody

abx025653-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Molybdenum Cofactor Synthesis 1 (MOCS1) Antibody

abx025653-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Molybdenum Cofactor Synthesis 1 (MOCS1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

miRNA First-Strand cDNA Synthesis SuperMix

abx098020-20rxns20ulSystems 20 rxns × 20 ul Systems
EUR 732
  • Shipped within 5-10 working days.

Fly First-Strand cDNA Synthesis SuperMix

  • EUR 718.00
  • EUR 578.00
  • 100 rxns × 20 ul Systems
  • 50 rxns × 20 ul Systems
  • Shipped within 5-10 working days.

Molybdenum Cofactor Synthesis 2 (MOCS2) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Molybdenum Cofactor Synthesis 2 (MOCS2) Antibody

abx036894-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Molybdenum Cofactor Synthesis 1 (MOCS1) Antibody

abx037731-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Molybdenum Cofactor Synthesis 1 (MOCS1) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Molybdenum Cofactor Synthesis 1 (MOCS1) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Molybdenum Cofactor Synthesis 2 (MOCS2) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Molybdenum Cofactor Synthesis 2 (MOCS2) Antibody

abx028710-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Molybdenum Cofactor Synthesis 2 (MOCS2) Antibody

abx028710-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Molybdenum Cofactor Synthesis 2 (MOCS2) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Molybdenum Cofactor Synthesis 2 (MOCS2) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Molybdenum Cofactor Synthesis 2 (MOCS2) Antibody

abx235264-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Molybdenum Cofactor Synthesis 1 (MOCS1) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Molybdenum Cofactor Synthesis 1 (MOCS1) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Molybdenum Cofactor Synthesis 2 (MOCS2) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

EZClick? Global Protein Synthesis Assay Kit

EUR 533

Optimax First Strand cDNA Synthesis Kit

K4201100 100 rnx
EUR 419

EpiNext Hi-Fi cDNA Synthesis Kit

P-9004 20 Samples
EUR 318.25
Description: Ask the seller for details

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

amfiRivert II cDNA Synthesis Master Mix

R5500-050 50 rxns
EUR 374

amfiRivert II cDNA Synthesis Master Mix

R5500-100 2x50rxns
EUR 577

amfiRivert cDNA Synthesis Prime Master Mix

R5610-050 50 rxns
EUR 412

amfiRivert cDNA Synthesis Prime Master Mix

R5610-100 2x50 rxns
EUR 671

amfiRivert cDNA Synthesis Prime Master Mix

R5610-200 4X50 rxns
EUR 1211

amfiRivert cDNA Synthesis Prime Master Mix

R5610-500 10x50 rxns
EUR 2548

amfiRivert Platinum cDNA Synthesis Premix(2X)

R5700-096 96 rxns
EUR 469

Recombinant Molybdenum Cofactor Synthesis 1 (MOCS1)

  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9NZB8
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 21.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Molybdenum Cofactor Synthesis 1 expressed in: E.coli

Recombinant Molybdenum Cofactor Synthesis 1 (MOCS1)

  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q5RKZ7
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 22.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Molybdenum Cofactor Synthesis 1 expressed in: E.coli

HiFiScript 1st Strand cDNA Synthesis Kit

W2569-10 NULL

HiFiScript 1st Strand cDNA Synthesis Kit

W2569-100 NULL

HiFiScript 1st Strand cDNA Synthesis Kit

W2569-30 NULL

Poly(ethylene glycol) methyl ether-block-poly(lactide-co-glycolide)

AV-2070-1 0.1 g
EUR 164