In Vitro Assays to Examine PD-1 Biology in Human T Cells

Our understanding of programmed cell demise 1 (PD-1) biology is proscribed as a result of technical difficulties in establishing reproducible, but easy, in vitro assays to check PD-1 signaling in main human T cells. The protocols on this article had been refined to check the implications of PD-1 ligation on short-term T cell signaling, long-term T cell perform, and the structural penalties of PD-1 ligation with PD-1 ligands. 

• Fundamental Protocol 1 addresses the necessity for a sturdy and reproducible short-term assay to look at the signaling cascade triggered by PD-1. We describe a phospho stream cytometry technique to find out how PD-1 ligation alters the extent of CD3ζ phosphorylation on Tyr¹⁴² , which might be simply utilized to different proximal signaling proteins.
  
  
• Fundamental Protocol 2 describes a plate-bound assay that’s helpful to look at the long-term penalties of PD-1 ligation comparable to cytokine manufacturing and T cell proliferation.
  
• Complementary to that, Fundamental Protocol Three describes an in vitro superantigen-based assay to judge T cell responses to therapeutic brokers focusing on the PD-1/PD-L axis, in addition to immune synapse formation within the presence of PD-1 engagement. Lastly, in Fundamental Protocol Four we define a tetramer-based technique helpful to interrogate the standard of PD-1/PD-L interactions.
  
• These protocols might be simply tailored for mouse research and different inhibitory receptors. They supply a beneficial useful resource to analyze PD-1 signaling in T cells and the purposeful penalties of varied PD-1-based therapeutics on T cell responses.
  
• © 2020 Wiley Periodicals LLC. Fundamental Protocol 1: PD-1 crosslinking assay to find out CD3ζ phosphorylation in main human T cells Fundamental Protocol 2: Plate-based ligand binding assay to check PD-1 perform in human T cells Help Protocol 1: T cell proliferation assay within the presence of PD-1 ligation Fundamental Protocol 3: In vitro APC/T cell co-culture system to judge therapeutic interventions focusing on the PD-1/PD-L1 axis Help Protocol 2: Microscopy-based strategy to judge the implications of PD-1 ligation on immune synapse formation Fundamental Protocol 4: Tetramer-based strategy to check PD-1/PD-L1 interactions.

Tailor-made Educating for Specialised (Para-)medical College students – Expertise From Incorporating a Related Genetic Illness All through a Course of Molecular Cell Biology

Worldwide, a compulsory course in Molecular Cell Biology is commonly a part of the (para-) medical curricula. Pupil audiences are commonly not receptive to such comparatively theoretical programs and academics typically battle to convey the mandatory data.

Right here, constructive expertise is shared on rigorously embedding a genetic illness that severely impacts the motion equipment, fibrodysplasia ossificans progressiva (FOP), in all points of a course for a global group of Analysis Grasp Human Motion Sciences college students. 

Varied molecular cell organic points of FOP had been systematically carried out within the course, protecting genetics, the biochemical penalties of the mutation, signaling pathways that have an effect on bone formation and lectures on methods to clone the mutation or treatment the mutation. College students had been invited to critically take into consideration methods to use the theories discovered within the course to investigate a analysis paper.

Through the sensible a part of the course, college students assisted in novel, innovative analysis on FOP affected person derived or management cells. Analysis findings had been reported in a analysis paper format. By constructing a Molecular Cell Biology course round an interesting illness, we managed to extend the overall motivation of the scholars for the course as mirrored in two particular questions of the course evaluations (p < 0.05).

It convincingly taught the relevance of a course of Molecular Cell Biology to college students with a main background in biomechanics and physiotherapy for his or her paramedical skilled life. This strategy of embedding an audience-tailored human illness with a recognized genetic trigger right into a course might be carried out to many medical curriculum associated programs and can improve college students’ notion of the relevance of a course. 

Human Hexokinase 1 (HK1) ELISA Kit
RD-HK1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 662

HK1 Rabbit pAb
A1054-100ul	Abclonal	100 ul	EUR 308

HK1 Rabbit pAb
A1054-200ul	Abclonal	200 ul	EUR 459

HK1 Rabbit pAb
A1054-20ul	Abclonal	20 ul	EUR 183

HK1 Rabbit pAb
A1054-50ul	Abclonal	50 ul	EUR 223

HK1 Rabbit pAb
A0546-100ul	Abclonal	100 ul	EUR 308

HK1 Rabbit pAb
A0546-200ul	Abclonal	200 ul	EUR 459

HK1 Rabbit pAb
A0546-20ul	Abclonal	20 ul	Ask for price

HK1 Rabbit pAb
A0546-50ul	Abclonal	50 ul	Ask for price

Rabbit HK1 ELISA Kit
ERTH0075	Abclonal	96Tests	EUR 521

HK1 antibody
70R-17747	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal HK1 antibody

HK1 antibody
70R-10229	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal HK1 antibody

HK1 antibody
70R-10230	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal HK1 antibody

HK1 Antibody
32133-100ul	SAB	100ul	EUR 252

HK1 antibody
10R-2226	Fitzgerald	100 ul	EUR 403
Description: Mouse monoclonal HK1 antibody

HK1 antibody
10R-2231	Fitzgerald	100 ul	EUR 403
Description: Mouse monoclonal HK1 antibody

HK1 Antibody
1-CSB-PA002994	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against HK1. Recognizes HK1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000

HK1 Antibody
1-CSB-PA093794	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against HK1. Recognizes HK1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

HK1 Antibody
1-CSB-PA643791	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against HK1. Recognizes HK1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

HK1 Antibody
DF6199	Affbiotech	200ul	EUR 304
Description: HK1 Antibody detects endogenous levels of total HK1.

HK1 Antibody
CSB-PA230660-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against HK1. Recognizes HK1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

HK1 Antibody
CSB-PA230660-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against HK1. Recognizes HK1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

HK1 antibody
70R-35878	Fitzgerald	100 ug	EUR 349
Description: Rabbit polyclonal HK1 antibody

HK1 Antibody
BF0126	Affbiotech	200ul	EUR 376
Description: HK1 antibody detects endogenous levels of total HK1.

HK1 Antibody
1-CSB-PA010468GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against HK1. Recognizes HK1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

HK1 Antibody
1-CSB-PA010468HA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HK1. Recognizes HK1 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

HK1 Antibody
1-CSB-PA010468LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HK1. Recognizes HK1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

HK1 Antibody
ABD6199	Lifescience Market	100 ug	EUR 438

[KO Validated] HK1 Rabbit mAb
A0533-100ul	Abclonal	100 ul	EUR 459

[KO Validated] HK1 Rabbit mAb
A0533-200ul	Abclonal	200 ul	EUR 686

[KO Validated] HK1 Rabbit mAb
A0533-20ul	Abclonal	20 ul	EUR 221

[KO Validated] HK1 Rabbit mAb
A0533-50ul	Abclonal	50 ul	EUR 308

HK1 Monoclonal Antibody
27098-100ul	SAB	100ul	EUR 252

HK1 Monoclonal Antibody
27098-50ul	SAB	50ul	EUR 187

HK1/HK2 antibody
31975-100ul	SAB	100ul	EUR 252

HK1/HK2 antibody
31975-50ul	SAB	50ul	EUR 187

HK1 Conjugated Antibody
C32133	SAB	100ul	EUR 397

HK1 Polyclonal Antibody
A54337	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

HK1 Polyclonal Antibody
A54597	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

anti- HK1 antibody
FNab03893	FN Test	100µg	EUR 505.25
Immunogen: hexokinase 1 Uniprot ID: P19367 Gene ID: 3098 Research Area: Cardiovascular, Metabolism
Description: Antibody raised against HK1

Anti-HK1 antibody
PAab03893	Lifescience Market	100 ug	EUR 355

Anti-HK1 antibody
STJ110988	St John's Laboratory	100 µl	EUR 277
Description: Hexokinases phosphorylate glucose to produce glucose-6-phosphate, the first step in most glucose metabolism pathways. This gene encodes a ubiquitous form of hexokinase which localizes to the outer membrane of mitochondria. Mutations in this gene have been associated with hemolytic anemia due to hexokinase deficiency. Alternative splicing of this gene results in several transcript variants which encode different isoforms, some of which are tissue-specific.

Anti-HK1 antibody
STJ24019	St John's Laboratory	100 µl	EUR 277
Description: Hexokinases phosphorylate glucose to produce glucose-6-phosphate, the first step in most glucose metabolism pathways. This gene encodes a ubiquitous form of hexokinase which localizes to the outer membrane of mitochondria. Mutations in this gene have been associated with hemolytic anemia due to hexokinase deficiency. Alternative splicing of this gene results in several transcript variants which encode different isoforms, some of which are tissue-specific.

Rabbit Anti-HK1 monoclonal antibody, clone TU58-16
DCABH-4091	Creative Diagnostics	100 ul	EUR 777

HK1 siRNA
20-abx902474	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

HK1 siRNA
20-abx919544	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

HK1 siRNA
20-abx919545	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Hexokinase 1 (HK1) Antibody
abx015885-100ul	Abbexa	100 ul	EUR 411
Shipped within 5-10 working days.

Hexokinase 1 (HK1) Antibody
20-abx214585	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Hexokinase 1 (HK1) Antibody
20-abx214586	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Hexokinase 1 (HK1) Antibody
20-abx100798	Abbexa	EUR 398.00 EUR 133.00 EUR 1107.00 EUR 537.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Hexokinase 1 (HK1) Antibody
20-abx100799	Abbexa	EUR 398.00 EUR 133.00 EUR 1107.00 EUR 537.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Hexokinase 1 (HK1) Antibody
20-abx100800	Abbexa	EUR 411.00 EUR 133.00 EUR 1135.00 EUR 551.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Hexokinase 1 (HK1) Antibody
20-abx100801	Abbexa	EUR 411.00 EUR 133.00 EUR 1135.00 EUR 551.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Hexokinase 1 (HK1) Antibody
20-abx100802	Abbexa	EUR 411.00 EUR 133.00 EUR 1135.00 EUR 551.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Hexokinase 1 (HK1) Antibody
20-abx100803	Abbexa	EUR 425.00 EUR 133.00 EUR 1177.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Hexokinase 1 (HK1) Antibody
20-abx112999	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Hexokinase 1 (HK1) Antibody
20-abx121415	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Hexokinase 1 (HK1) Antibody
20-abx125339	Abbexa	EUR 495.00 EUR 704.00 EUR 356.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Hexokinase 1 (HK1) Antibody
20-abx126932	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Hexokinase 1 (HK1) Antibody
abx036294-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Hexokinase 1 (HK1) Antibody
20-abx130172	Abbexa	EUR 425.00 EUR 133.00 EUR 1177.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Hexokinase-1 (HK1) Antibody
20-abx137282	Abbexa	EUR 704.00 EUR 328.00 EUR 230.00	100 ug 20 ug 5 ug
Shipped within 5-10 working days.

Hexokinase 1 (HK1) Antibody
20-abx109871	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Hexokinase 1 (HK1) Antibody
20-abx109872	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Hexokinase 1 (HK1) Antibody
abx159534-100ul	Abbexa	100 ul	EUR 467
Shipped within 5-10 working days.

Hexokinase 1 (HK1) Antibody
20-abx172800	Abbexa	EUR 787.00 EUR 411.00	1 mg 200 ug
Please enquire.

Hexokinase 1 (HK1) Antibody
abx010915-100ul	Abbexa	100 ul	EUR 411
Shipped within 5-10 working days.

Hexokinase 1 (HK1) Antibody
abx033903-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Hexokinase 1 (HK1) Antibody
abx033903-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Hexokinase 1 (HK1) Antibody
abx033904-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Hexokinase 1 (HK1) Antibody
abx033904-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

HK1 Conjugated Monoclonal Antibody
C27098	SAB	100ul	EUR 397

HK1 Antibody, HRP conjugated
1-CSB-PA010468HB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HK1. Recognizes HK1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

HK1 Antibody, FITC conjugated
1-CSB-PA010468HC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HK1. Recognizes HK1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

HK1 Antibody, Biotin conjugated
1-CSB-PA010468HD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HK1. Recognizes HK1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

HK1 Antibody, HRP conjugated
1-CSB-PA010468LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HK1. Recognizes HK1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

HK1 Antibody, FITC conjugated
1-CSB-PA010468LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HK1. Recognizes HK1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

HK1 Antibody, Biotin conjugated
1-CSB-PA010468LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HK1. Recognizes HK1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Hexokinase 1 (HK1) Antibody
abx233847-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Hexokinase 1 (HK1) Antibody
abx233893-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Hexokinase 1 (HK1) Antibody
20-abx329456	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Hexokinase 1 (HK1) Antibody
abx332645-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

Hexokinase 1 (HK1) Antibody
20-abx000977	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Anti-Hexokinase 1/HK1 Antibody
A01504-1	BosterBio	100ug/vial	EUR 334

Hexokinase 1 (HK1) Antibody (Biotin)
20-abx105515	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Hexokinase 1 (HK1) Antibody (Biotin)
20-abx105516	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Hexokinase 1 (HK1) Antibody (FITC)
20-abx106932	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Hexokinase 1 (HK1) Antibody (FITC)
20-abx106933	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Hexokinase 1 (HK1) Antibody (HRP)
20-abx107872	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Hexokinase 1 (HK1) Antibody (HRP)
20-abx108354	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

HK1/HK2 Polyclonal Conjugated Antibody
C31975	SAB	100ul	EUR 397

Monoclonal HK1 Antibody, Clone: 3A10
APR07757G	Leading Biology	0.1ml	EUR 484
Description: A Monoclonal antibody against Human HK1. The antibodies are raised in Mouse and are from clone 3A10. This antibody is applicable in WB and IHC, FC, ICC, E

Polyclonal HK1 Antibody (C-term)
APR07758G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HK1 (C-term). This antibody is tested and proven to work in the following applications:

Hexokinase 1 (HK1) Antibody (Biotin)
20-abx272040	Abbexa	EUR 425.00 EUR 230.00 EUR 1191.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Hexokinase 1 (HK1) Antibody (Biotin)
20-abx272736	Abbexa	EUR 425.00 EUR 230.00 EUR 1219.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Hexokinase 1 (HK1) Antibody (Biotin)
20-abx273208	Abbexa	EUR 481.00 EUR 244.00 EUR 1414.00 EUR 662.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Monoclonal HK1 Antibody, Clone: 7A7
AMM02783G	Leading Biology	0.1ml	EUR 484
Description: A Monoclonal antibody against Human HK1. The antibodies are raised in Mouse and are from clone 7A7. This antibody is applicable in WB and IHC, ICC, E

HK1 Polyclonal Antibody, Biotin Conjugated
A54338	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

HK1 Polyclonal Antibody, FITC Conjugated
A54339	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

HK1 Polyclonal Antibody, HRP Conjugated
A54340	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

HK1 Polyclonal Antibody, HRP Conjugated
A54598	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

HK1 Polyclonal Antibody, FITC Conjugated
A54599	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

HK1 Polyclonal Antibody, Biotin Conjugated
A54600	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

[One Step] HK1 Antibody Kit
RK05655	Abclonal	50 ul	EUR 240

Anti-HK1 (KO Validated) Antibody
A2125-100	Biovision	100 µl	EUR 465

HK1 Blocking Peptide
33R-4063	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HK1 antibody, catalog no. 70R-10229

HK1 Blocking Peptide
33R-1787	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HK1 antibody, catalog no. 70R-10230

HK1 Blocking Peptide
DF6199-BP	Affbiotech	1mg	EUR 195

HK1 Blocking Peptide
BF0126-BP	Affbiotech	1mg	EUR 195

HK1 cloning plasmid
CSB-CL010468HU-10ug	Cusabio	10ug	EUR 558
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2754 Sequence: atgatcgccgcgcagctcctggcctattacttcacggagctgaaggatgaccaggtcaaaaagattgacaagtatctgtatgccatgcggctctccgatgaaactctcatagatatcatgactcgcttcaggaaggagatgaagaatggcctctcccgggattttaatccaacag Show more
Description: A cloning plasmid for the HK1 gene.

anti-HK1 (7A7)
LF-MA30442	Abfrontier	100 ul	EUR 486
Description: Mouse Monoclonal to HK1

anti-HK1 (3A10)
LF-MA30447	Abfrontier	100 ul	EUR 486
Description: Mouse Monoclonal to HK1

pENTR223-HK1 vector
PVT11902	Lifescience Market	2 ug	EUR 308

Polyclonal HK1 antibody - N-terminal region
APR07759G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HK1 - N-terminal region. This antibody is tested and proven to work in the following applications:

Hexokinase 1 (HK1) Polyclonal Antibody (Human)
4-PAA775Hu01	Cloud-Clone	EUR 232.00 EUR 2285.00 EUR 574.00 EUR 289.00 EUR 208.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HK1 (Phe80~Met215) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hexokinase 1 (HK1)

Hexokinase 1 (HK1) Polyclonal Antibody (Human)
4-PAA775Hu02	Cloud-Clone	EUR 232.00 EUR 2285.00 EUR 574.00 EUR 289.00 EUR 208.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HK1 (Asp413~Val540) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hexokinase 1 (HK1)

Hexokinase 1 (HK1) Polyclonal Antibody (Mouse)
4-PAA775Mu02	Cloud-Clone	EUR 236.00 EUR 2338.00 EUR 586.00 EUR 294.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HK1 (Ala530~Gly675) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Hexokinase 1 (HK1)

Hexokinase 1 (HK1) Polyclonal Antibody (Mouse)
4-PAA775Mu03	Cloud-Clone	EUR 236.00 EUR 2338.00 EUR 586.00 EUR 294.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HK1 (Leu676~Val800) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Hexokinase 1 (HK1)

Hexokinase 1 (HK1) Polyclonal Antibody (Rat)
4-PAA775Ra01	Cloud-Clone	EUR 243.00 EUR 2457.00 EUR 613.00 EUR 305.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HK1 (Phe80~Met215) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Hexokinase 1 (HK1)

Hexokinase 1 (HK1) Polyclonal Antibody (Rat)
4-PAA775Ra02	Cloud-Clone	EUR 243.00 EUR 2457.00 EUR 613.00 EUR 305.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HK1 (Asp413~Val540) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Hexokinase 1 (HK1)

Human Hexokinase-1 (HK1)
1-CSB-EP010468HU(F1)	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 55.9 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Hexokinase-1(HK1),partial expressed in E.coli

Human Hexokinase-1 (HK1)
1-CSB-EP010468HU(F2)	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 65.3 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Hexokinase-1(HK1),partial expressed in E.coli

Human Hexokinase-1 (HK1)
1-CSB-EP010468HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 106.5 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Hexokinase-1(HK1) expressed in E.coli

Human Hexokinase-1 (HK1)
1-CSB-YP010468HU(F1)	Cusabio	EUR 430.00 EUR 234.00 EUR 1508.00 EUR 642.00 EUR 1009.00 EUR 291.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 53.9 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Hexokinase-1(HK1) ,partial expressed in Yeast

Human HK1 ELISA Kit
EHH0075	Abclonal	96Tests	EUR 521

Human HK1 ELISA Kit
ELA-E0775h	Lifescience Market	96 Tests	EUR 824

Goat HK1 ELISA Kit
EGTH0075	Abclonal	96Tests	EUR 521

Bovine HK1 ELISA Kit
EBH0075	Abclonal	96Tests	EUR 521

Canine HK1 ELISA Kit
ECH0075	Abclonal	96Tests	EUR 521

Chicken HK1 ELISA Kit
ECKH0075	Abclonal	96Tests	EUR 521

Anserini HK1 ELISA Kit
EAH0075	Abclonal	96Tests	EUR 521

HK1 ELISA KIT|Human
EF005611	Lifescience Market	96 Tests	EUR 689

Rat HK1 shRNA Plasmid
20-abx984767	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human HK1 shRNA Plasmid
20-abx952111	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse HK1 shRNA Plasmid
20-abx970812	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat HK1 ELISA Kit
ERH0075	Abclonal	96Tests	EUR 521

Mouse HK1 ELISA Kit
EMH0075	Abclonal	96Tests	EUR 521

Monkey HK1 ELISA Kit
EMKH0075	Abclonal	96Tests	EUR 521

Porcine HK1 ELISA Kit
EPH0075	Abclonal	96Tests	EUR 521

Recombinant Hexokinase 1 (HK1)
4-RPA775Hu01	Cloud-Clone	EUR 467.36 EUR 228.00 EUR 1477.60 EUR 559.20 EUR 1018.40 EUR 376.00 EUR 3544.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P19367 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 16.5kDa Isoelectric Point: Inquire
Description: Recombinant Human Hexokinase 1 expressed in: E.coli

Recombinant Hexokinase 1 (HK1)
4-RPA775Hu02	Cloud-Clone	EUR 467.36 EUR 228.00 EUR 1477.60 EUR 559.20 EUR 1018.40 EUR 376.00 EUR 3544.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P19367 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 41.7kDa Isoelectric Point: Inquire
Description: Recombinant Human Hexokinase 1 expressed in: E.coli

Recombinant Hexokinase 1 (HK1)
4-RPA775Mu01	Cloud-Clone	EUR 481.70 EUR 232.00 EUR 1531.36 EUR 577.12 EUR 1054.24 EUR 385.00 EUR 3678.40	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P17710 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 16.4kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Hexokinase 1 expressed in: E.coli

Recombinant Hexokinase 1 (HK1)
4-RPA775Mu02	Cloud-Clone	EUR 481.70 EUR 232.00 EUR 1531.36 EUR 577.12 EUR 1054.24 EUR 385.00 EUR 3678.40	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P17710 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 17.7kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Hexokinase 1 expressed in: E.coli

Recombinant Hexokinase 1 (HK1)
4-RPA775Mu03	Cloud-Clone	EUR 481.70 EUR 232.00 EUR 1531.36 EUR 577.12 EUR 1054.24 EUR 385.00 EUR 3678.40	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P17710 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 15.7kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Hexokinase 1 expressed in: E.coli

Recombinant Hexokinase 1 (HK1)
4-RPA775Ra01	Cloud-Clone	EUR 494.24 EUR 235.00 EUR 1578.40 EUR 592.80 EUR 1085.60 EUR 394.00 EUR 3796.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P05708 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 16.7kDa Isoelectric Point: 7.1
Description: Recombinant Rat Hexokinase 1 expressed in: E.coli

Recombinant Hexokinase 1 (HK1)
4-RPA775Ra02	Cloud-Clone	EUR 494.24 EUR 235.00 EUR 1578.40 EUR 592.80 EUR 1085.60 EUR 394.00 EUR 3796.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P05708 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 46.6kDa Isoelectric Point: 7.7
Description: Recombinant Rat Hexokinase 1 expressed in: E.coli

Hexokinase 1 (HK1) Polyclonal Antibody (Human), APC
4-PAA775Hu01-APC	Cloud-Clone	EUR 323.00 EUR 2969.00 EUR 836.00 EUR 409.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HK1 (Phe80~Met215) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hexokinase 1 (HK1). This antibody is labeled with APC.

Hexokinase 1 (HK1) Polyclonal Antibody (Human), Biotinylated
4-PAA775Hu01-Biotin	Cloud-Clone	EUR 295.00 EUR 2235.00 EUR 671.00 EUR 358.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HK1 (Phe80~Met215) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hexokinase 1 (HK1). This antibody is labeled with Biotin.

Hexokinase 1 (HK1) Polyclonal Antibody (Human), Cy3
4-PAA775Hu01-Cy3	Cloud-Clone	EUR 390.00 EUR 3917.00 EUR 1073.00 EUR 504.00 EUR 239.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HK1 (Phe80~Met215) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hexokinase 1 (HK1). This antibody is labeled with Cy3.

Hexokinase 1 (HK1) Polyclonal Antibody (Human), FITC
4-PAA775Hu01-FITC	Cloud-Clone	EUR 279.00 EUR 2395.00 EUR 688.00 EUR 347.00 EUR 188.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HK1 (Phe80~Met215) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hexokinase 1 (HK1). This antibody is labeled with FITC.

Hexokinase 1 (HK1) Polyclonal Antibody (Human), HRP
4-PAA775Hu01-HRP	Cloud-Clone	EUR 297.00 EUR 2589.00 EUR 741.00 EUR 371.00 EUR 199.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HK1 (Phe80~Met215) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hexokinase 1 (HK1). This antibody is labeled with HRP.

Hexokinase 1 (HK1) Polyclonal Antibody (Human), PE
4-PAA775Hu01-PE	Cloud-Clone	EUR 279.00 EUR 2395.00 EUR 688.00 EUR 347.00 EUR 188.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HK1 (Phe80~Met215) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hexokinase 1 (HK1). This antibody is labeled with PE.

Hexokinase 1 (HK1) Polyclonal Antibody (Human), APC
4-PAA775Hu02-APC	Cloud-Clone	EUR 323.00 EUR 2969.00 EUR 836.00 EUR 409.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HK1 (Asp413~Val540) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hexokinase 1 (HK1). This antibody is labeled with APC.

Hexokinase 1 (HK1) Polyclonal Antibody (Human), Biotinylated
4-PAA775Hu02-Biotin	Cloud-Clone	EUR 295.00 EUR 2235.00 EUR 671.00 EUR 358.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HK1 (Asp413~Val540) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hexokinase 1 (HK1). This antibody is labeled with Biotin.

Hexokinase 1 (HK1) Polyclonal Antibody (Human), Cy3
4-PAA775Hu02-Cy3	Cloud-Clone	EUR 390.00 EUR 3917.00 EUR 1073.00 EUR 504.00 EUR 239.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HK1 (Asp413~Val540) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hexokinase 1 (HK1). This antibody is labeled with Cy3.

Hexokinase 1 (HK1) Polyclonal Antibody (Human), FITC
4-PAA775Hu02-FITC	Cloud-Clone	EUR 279.00 EUR 2395.00 EUR 688.00 EUR 347.00 EUR 188.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HK1 (Asp413~Val540) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hexokinase 1 (HK1). This antibody is labeled with FITC.

Hexokinase 1 (HK1) Polyclonal Antibody (Human), HRP
4-PAA775Hu02-HRP	Cloud-Clone	EUR 297.00 EUR 2589.00 EUR 741.00 EUR 371.00 EUR 199.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HK1 (Asp413~Val540) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hexokinase 1 (HK1). This antibody is labeled with HRP.

Hexokinase 1 (HK1) Polyclonal Antibody (Human), PE
4-PAA775Hu02-PE	Cloud-Clone	EUR 279.00 EUR 2395.00 EUR 688.00 EUR 347.00 EUR 188.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HK1 (Asp413~Val540) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hexokinase 1 (HK1). This antibody is labeled with PE.

Hexokinase 1 (HK1) Polyclonal Antibody (Human, Mouse)
4-PAA775Mu01	Cloud-Clone	EUR 236.00 EUR 2338.00 EUR 586.00 EUR 294.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HK1 (Phe137~Leu270) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Hexokinase 1 (HK1)

Hexokinase 1 (HK1) Polyclonal Antibody (Mouse), APC
4-PAA775Mu02-APC	Cloud-Clone	EUR 329.00 EUR 3041.00 EUR 854.00 EUR 416.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HK1 (Ala530~Gly675) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Hexokinase 1 (HK1). This antibody is labeled with APC.

Hexokinase 1 (HK1) Polyclonal Antibody (Mouse), Biotinylated
4-PAA775Mu02-Biotin	Cloud-Clone	EUR 299.00 EUR 2288.00 EUR 684.00 EUR 363.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HK1 (Ala530~Gly675) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Hexokinase 1 (HK1). This antibody is labeled with Biotin.

Hexokinase 1 (HK1) Polyclonal Antibody (Mouse), Cy3
4-PAA775Mu02-Cy3	Cloud-Clone	EUR 397.00 EUR 4013.00 EUR 1097.00 EUR 513.00 EUR 241.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HK1 (Ala530~Gly675) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Hexokinase 1 (HK1). This antibody is labeled with Cy3.

Hexokinase 1 (HK1) Polyclonal Antibody (Mouse), FITC
4-PAA775Mu02-FITC	Cloud-Clone	EUR 283.00 EUR 2452.00 EUR 703.00 EUR 353.00 EUR 189.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HK1 (Ala530~Gly675) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Hexokinase 1 (HK1). This antibody is labeled with FITC.

Hexokinase 1 (HK1) Polyclonal Antibody (Mouse), HRP
4-PAA775Mu02-HRP	Cloud-Clone	EUR 302.00 EUR 2652.00 EUR 756.00 EUR 377.00 EUR 200.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HK1 (Ala530~Gly675) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Hexokinase 1 (HK1). This antibody is labeled with HRP.

Hexokinase 1 (HK1) Polyclonal Antibody (Mouse), PE
4-PAA775Mu02-PE	Cloud-Clone	EUR 283.00 EUR 2452.00 EUR 703.00 EUR 353.00 EUR 189.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HK1 (Ala530~Gly675) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Hexokinase 1 (HK1). This antibody is labeled with PE.

Hexokinase 1 (HK1) Polyclonal Antibody (Mouse), APC
4-PAA775Mu03-APC	Cloud-Clone	EUR 329.00 EUR 3041.00 EUR 854.00 EUR 416.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HK1 (Leu676~Val800) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Hexokinase 1 (HK1). This antibody is labeled with APC.

Focusing on A number of Myeloma by way of the Biology of Lengthy-Lived Plasma Cells

A number of myeloma (MM) is a hematological malignancy of terminally differentiated bone marrow (BM) resident B lymphocytes referred to as plasma cells (PC). PC that reside within the bone marrow embrace a definite inhabitants of long-lived plasma cells (LLPC) which have the capability to stay for very lengthy intervals of time (a long time within the human inhabitants).

LLPC biology is essential for understanding MM illness induction and development as a result of MM shares lots of the similar extrinsic and intrinsic survival applications as LLPC. Extrinsic survival alerts required for LLPC survival embrace soluble elements and mobile companions within the bone marrow microenvironment. Intrinsic applications that improve mobile constancy are additionally required for LLPC survival together with elevated autophagy, metabolic health, the unfolded protein response (UPR), and enhanced responsiveness to endoplasmic reticulum (ER) stress.

Focusing on LLPC cell survival mechanisms have led to straightforward of care therapies for MM together with proteasome inhibition (Bortezomib), steroids (Dexamethasone), and immunomodulatory medication (Lenalidomide). MM sufferers that relapse typically accomplish that by circumventing LLPC survival pathways focused by therapy. Understanding the mechanisms by which LLPC are capable of survive can enable us perception into the therapy of MM, which permits for the enhancement of therapeutic methods in MM each at analysis and upon affected person relapse.   

Thiourea
GE8159-5KG	Glentham Life Sciences	5 kg	EUR 225

Thiourea
TB1943	Bio Basic	500g	EUR 67.4
Product category: Biochemicals/Biology Reagents/Protein Related

Ethylene glycol
20-abx184690	Abbexa	EUR 217.00 EUR 509.00 EUR 189.00 EUR 370.00 EUR 175.00	100 g 1 kg 25 g 500 g 5 g
Shipped within 1-2 weeks.

Ethylene glycol
GK7641-100ML	Glentham Life Sciences	100 ml	EUR 38

Ethylene glycol
GK7641-1L	Glentham Life Sciences	1 l	EUR 54

Ethylene glycol
GK7641-500ML	Glentham Life Sciences	500 ml	EUR 44

Ethylene glycol
GK7641-5L	Glentham Life Sciences	5 l	EUR 114

Ethylene glycol
ED0199	Bio Basic	250ml	EUR 58.7
Product category: Biochemicals/Misc. Biochemicals

2-Methylamino Thiourea
abx187868-100g	Abbexa	100 g	EUR 300
Shipped within 1-2 weeks.

cDNA Synthesis SuperMix for qPCR
20-abx09801920ulSystems	Abbexa	EUR 690.00 EUR 565.00	100 rxns ×20 ul Systems 50 rxns × 20 ul Systems
Shipped within 5-10 working days.

Trifluoroacetic acid, Ultrapure for synthesis
GK2000-100ML	Glentham Life Sciences	100 ml	EUR 70

Trifluoroacetic acid, Ultrapure for synthesis
GK2000-1L	Glentham Life Sciences	1 l	EUR 293

5-Bromovaleraldehyde Ethylene Acetal
20-abx186074	Abbexa	EUR 704.00 EUR 272.00 EUR 495.00	10 g 1 g 5 g
Shipped within 1-2 weeks.

1,1,3,3-Tetramethyl-2-thiourea
20-abx186112	Abbexa	EUR 272.00 EUR 1121.00	25 g 500 g
Shipped within 1-2 weeks.

mono-(BOC)-ethylene diamine
20-abx184234	Abbexa	EUR 272.00 EUR 203.00 EUR 648.00	100 g 25 g 500 g
Shipped within 1-2 weeks.

1,3-Diethyl-2-thiourea
GK7697-250G	Glentham Life Sciences	250 g	EUR 62

1,3-Diethyl-2-thiourea
GK7697-25G	Glentham Life Sciences	25 g	EUR 44

Chlorobis(Ethylene)Rhodium(I)Dimer
20-abx188647	Abbexa	EUR 356.00 EUR 1191.00 EUR 565.00 EUR 871.00	100 mg 1 g 250 mg 500 mg
Shipped within 1-2 weeks.

Poly(Ethylene Glycol) (N) Monomethacrylate
20-abx188846	Abbexa	EUR 370.00 EUR 217.00	100 g 25 g
Shipped within 1-2 weeks.

Poly(ethylene glycol methyl ether)
abx181345-1000g	Abbexa	1000 g	EUR 342
Shipped within 1-2 weeks.

Trans-1,2-Bis(Tributylstannyl)Ethylene
20-abx181364	Abbexa	EUR 244.00 EUR 1288.00 EUR 398.00	1 g 25 g 5 g
Shipped within 1-2 weeks.

N-Boc-n'-methyl thiourea
20-abx185514	Abbexa	EUR 954.00 EUR 481.00	1 g 250 mg
Shipped within 1-2 weeks.

First-Strand cDNA Synthesis SuperMix for PCR
abx098018-50rxns20ulSystems	Abbexa	50 rxns × 20 ul Systems	EUR 578
Shipped within 5-10 working days.

cDNA Synthesis SuperMix for qPCR (GC-rich)
abx098024-50rxns20ulSystems	Abbexa	50 rxns × 20 ul Systems	EUR 718
Shipped within 5-10 working days.

Tri(Ethylene Glycol) Di-P-Toluenesulfonate
20-abx186587	Abbexa	EUR 286.00 EUR 230.00	25 g 5 g
Shipped within 1-2 weeks.

cDNA Synthesis SuperMix
20-abx09801420ulSystems	Abbexa	EUR 565.00 EUR 481.00	100 rxns × 20 ul Systems 50 rxns × 20 ul Systems
Shipped within 5-10 working days.

OneScriptcDNA Synthesis Kit
G233	ABM	25 x 20 ul reactions	EUR 89

OneScriptcDNA Synthesis Kit
G234	ABM	100 x 20 ul reactions	EUR 141

OneScriptcDNA Synthesis SuperMix
G451	ABM	25 x 20 ul reactions	EUR 89

OneScriptcDNA Synthesis SuperMix
G452	ABM	100 x 20 ul reactions	EUR 141

Extraction Buffer for 2D Gel with Diluent, 50ml Urea, Thiourea and CHAPS
PL039	Bio Basic	50ml	EUR 72.62
Product category: Electrophoresis Related/Buffers

Tetro cDNA Synthesis Kit
BIO-65042	Bioline	30 Reactions	Ask for price

Tetro cDNA Synthesis Kit
BIO-65043	Bioline	100 Reactions	Ask for price

SensiFAST cDNA Synthesis Kit
BIO-65053	Bioline	50 Reactions	Ask for price

SensiFAST cDNA Synthesis Kit
BIO-65053/S	Bioline	Sample	Ask for price

SensiFAST cDNA Synthesis Kit
BIO-65054	Bioline	250 Reactions	Ask for price

OneScriptPlus cDNA Synthesis Kit
G235	ABM	25 x 20 ul reactions	EUR 97

OneScriptPlus cDNA Synthesis Kit
G236	ABM	100 x 20 ul reactions	EUR 169

OneScriptPlus cDNA Synthesis SuperMix
G453	ABM	25 x 20 ul reactions	EUR 97

OneScriptPlus cDNA Synthesis SuperMix
G454	ABM	100 x 20 ul reactions	EUR 169

circRNA cDNA Synthesis Kit
G627	ABM	25 rxn (20 ul/rxn)	EUR 309

CRISPR sgRNA Synthesis Kit
K1251-25	Biovision		EUR 403

Glutamine Synthesis stable cells
SC013	GenTarget	2 x 106 cell/ml x 1ml	EUR 1210
Description: Stable cell line expressing Glutamine Synthesis gene and RFP with Blasticidin resistance

All-in-One First-Strand cDNA Synthesis SuperMix for PCR
abx098023-50rxns20ulSystems	Abbexa	50 rxns × 20 ul Systems	EUR 732
Shipped within 5-10 working days.

Extraction Buffer for 2D Gel with Diluent, 50ml Urea, Thiourea, CHAPS and ASB-16
PL040	Bio Basic	50ml	EUR 115.25
Product category: Electrophoresis Related/Buffers

Extraction Buffer for 2D Gel with Diluent, 50ml Urea, Thiourea, CHAPS and NDSB 201
PL042	Bio Basic	50ml	EUR 91.76
Product category: Electrophoresis Related/Buffers

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

Molybdenum Cofactor Synthesis 2 Protein
20-abx263321	Abbexa	EUR 1609.00 EUR 328.00 EUR 230.00	100 ug 10 ug 2 µg
Shipped within 5-10 working days.

Total-Transcriptome cDNA Synthesis Kit
G904	ABM	25 reactions	EUR 224

Total-Transcriptome cDNA Synthesis Kit
G905	ABM	100 reactions	EUR 544

Classic CRISPR sgRNA Synthesis Kit
K1252-25	Biovision	25 Reactions	EUR 439
Kit components: 2X Classic sgRNA Synthesis SuperMix Scaffold Template and Primer sgRNA Control Oligo (10 ?M) OneScribe Enzyme Mix DNase I, RNase-Free (2 U/?l) 10X DNase I Reaction Buffer DistantTM PCR Mix (#M1136-200) Nuclease-free H2O
Description: Classic CRISPR sgRNA Synthesis Kit

Express CRISPR sgRNA Synthesis Kit
K1253-25	Biovision		EUR 533

Custom Peptide Synthesis order form
Pepord-1	Alpha Diagnostics	1	Ask for price

Accuris qMax cDNA Synthesis Kit
PR2100-C-100	BenchMark	1 PC	EUR 337.75
To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

Accuris qMax cDNA Synthesis Kit
PR2100-C-25	BenchMark	1 PC	EUR 142.36
To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

Accuris qMax cDNA Synthesis Kit
PR2100-C-250	BenchMark	1 PC	EUR 711.77
To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

Accuris qMax cDNA Synthesis Kit
PR2100-C-S	BenchMark	1 PC	EUR 77.76
To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

amfiRivert cDNA Synthesis Master Mix
R5101-050	GenDepot	50 rxns	EUR 415

amfiRivert cDNA Synthesis Master Mix
R5101-100	GenDepot	2X50 rxns	EUR 847

amfiRivert cDNA Synthesis Master Mix
R5101-200	GenDepot	4X50 rxns	EUR 1211

amfiRivet cDNA Synthesis 2X Buffer
R5102-050	GenDepot	500ul	EUR 134

amfiRivet cDNA Synthesis 2X Buffer
R5102-100	GenDepot	2x500ul	EUR 192

Mitomycin C (DNA synthesis inhibitor)
SIH-246-10MG	Stressmarq	10 mg	EUR 149
The mitomycins are a family of aziridine containing natural products. Mitomycin C is a chemotherapeutic agent because of its mechanism of potent DNA crosslinker, reductive activation followed by two N-alklyations. Both alkylations are sequence specif Show more
Description: The substance Mitomycin C is a dna synthesis inhibitor. It is synthetically produced and has a purity of >99%. The pure substance is dark purple crystalline solid which is May be dissolved in DMSO (15mg/mL); or water (1mg/mL, warm).

Mitomycin C (DNA synthesis inhibitor)
SIH-246-50MG	Stressmarq	50 mg	EUR 373
The mitomycins are a family of aziridine containing natural products. Mitomycin C is a chemotherapeutic agent because of its mechanism of potent DNA crosslinker, reductive activation followed by two N-alklyations. Both alkylations are sequence specif Show more
Description: The substance Mitomycin C is a dna synthesis inhibitor. It is synthetically produced and has a purity of >99%. The pure substance is dark purple crystalline solid which is May be dissolved in DMSO (15mg/mL); or water (1mg/mL, warm).

Holder for Plasmid Midi, Maxi and Maxi plus, Ion Exchange column
FAPDE-holder-for-ion-exchange	Favorgen	1 prep	EUR 158

Poly(ethylene glycol) methyl ether (mPEG) Molecular Weight: 20000
PEG-20K	Alpha Diagnostics	100 mg	EUR 225

Extraction Buffer for 2D Gel with Diluent, 50ml Urea, Thiourea, CHAPS and SB 3-10
PL041	Bio Basic	50ml	EUR 91.76
Product category: Electrophoresis Related/Buffers

All-in-One cDNA Synthesis SuperMix
B24403	Bimake	200 ractions	EUR 456
Description: All-in-One cDNA Synthesis SuperMix contains all the necessary components pre-blended in one tube for reverse transcription.

All-in-One cDNA Synthesis SuperMix
B24408	Bimake	1000 ractions	EUR 1453
Description: All-in-One cDNA Synthesis SuperMix contains all the necessary components pre-blended in one tube for reverse transcription.

AzuraQuant cDNA Synthesis Kit - 25 Reactions
AZ-1995	Real Time Primers	25 Reactions	EUR 153

AzuraQuant cDNA Synthesis Kit - 100 Reactions
AZ-1996	Real Time Primers	100 Reactions	EUR 372

Molybdenum Cofactor Synthesis 1 (MOCS1) Antibody
abx025653-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Molybdenum Cofactor Synthesis 1 (MOCS1) Antibody
abx025653-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Molybdenum Cofactor Synthesis 1 (MOCS1) Antibody
20-abx005887	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

miRNA First-Strand cDNA Synthesis SuperMix
abx098020-20rxns20ulSystems	Abbexa	20 rxns × 20 ul Systems	EUR 732
Shipped within 5-10 working days.

Fly First-Strand cDNA Synthesis SuperMix
20-abx09885820ulSystems	Abbexa	EUR 718.00 EUR 578.00	100 rxns × 20 ul Systems 50 rxns × 20 ul Systems
Shipped within 5-10 working days.

Molybdenum Cofactor Synthesis 2 (MOCS2) Antibody
20-abx113871	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Molybdenum Cofactor Synthesis 2 (MOCS2) Antibody
abx036894-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Molybdenum Cofactor Synthesis 1 (MOCS1) Antibody
abx037731-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Molybdenum Cofactor Synthesis 1 (MOCS1) Antibody
20-abx131326	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Molybdenum Cofactor Synthesis 1 (MOCS1) Antibody
20-abx131327	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Molybdenum Cofactor Synthesis 2 (MOCS2) Antibody
20-abx135733	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Molybdenum Cofactor Synthesis 2 (MOCS2) Antibody
abx028710-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Molybdenum Cofactor Synthesis 2 (MOCS2) Antibody
abx028710-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Molybdenum Cofactor Synthesis 2 (MOCS2) Antibody
20-abx321401	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Molybdenum Cofactor Synthesis 2 (MOCS2) Antibody
20-abx321402	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Molybdenum Cofactor Synthesis 2 (MOCS2) Antibody
abx235264-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Molybdenum Cofactor Synthesis 1 (MOCS1) Antibody
20-abx321947	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Molybdenum Cofactor Synthesis 1 (MOCS1) Antibody
20-abx322547	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Molybdenum Cofactor Synthesis 2 (MOCS2) Antibody
20-abx304514	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

EZClick? Global Protein Synthesis Assay Kit
K467-100	Biovision		EUR 533

Optimax First Strand cDNA Synthesis Kit
K4201100	Biochain	100 rnx	EUR 419

EpiNext Hi-Fi cDNA Synthesis Kit
P-9004	EpiGentek	20 Samples	EUR 318.25
Description: Ask the seller for details

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1	SBI	5 reactions	EUR 1152
Category: Stem Cell Products

amfiRivert II cDNA Synthesis Master Mix
R5500-050	GenDepot	50 rxns	EUR 374

amfiRivert II cDNA Synthesis Master Mix
R5500-100	GenDepot	2x50rxns	EUR 577

amfiRivert cDNA Synthesis Prime Master Mix
R5610-050	GenDepot	50 rxns	EUR 412

amfiRivert cDNA Synthesis Prime Master Mix
R5610-100	GenDepot	2x50 rxns	EUR 671

amfiRivert cDNA Synthesis Prime Master Mix
R5610-200	GenDepot	4X50 rxns	EUR 1211

amfiRivert cDNA Synthesis Prime Master Mix
R5610-500	GenDepot	10x50 rxns	EUR 2548

amfiRivert Platinum cDNA Synthesis Premix(2X)
R5700-096	GenDepot	96 rxns	EUR 469

Recombinant Molybdenum Cofactor Synthesis 1 (MOCS1)
4-RPC623Hu01	Cloud-Clone	EUR 503.20 EUR 238.00 EUR 1612.00 EUR 604.00 EUR 1108.00 EUR 400.00 EUR 3880.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9NZB8 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 21.5kDa Isoelectric Point: Inquire
Description: Recombinant Human Molybdenum Cofactor Synthesis 1 expressed in: E.coli

Recombinant Molybdenum Cofactor Synthesis 1 (MOCS1)
4-RPC623Mu01	Cloud-Clone	EUR 458.40 EUR 226.00 EUR 1444.00 EUR 548.00 EUR 996.00 EUR 370.00 EUR 3460.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q5RKZ7 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 22.4kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Molybdenum Cofactor Synthesis 1 expressed in: E.coli

HiFiScript 1st Strand cDNA Synthesis Kit
W2569-10	101Bio	NULL	EUR 0

HiFiScript 1st Strand cDNA Synthesis Kit
W2569-100	101Bio	NULL	EUR 0

HiFiScript 1st Strand cDNA Synthesis Kit
W2569-30	101Bio	NULL	EUR 0

Poly(ethylene glycol) methyl ether-block-poly(lactide-co-glycolide)
AV-2070-1